ID: 985927552

View in Genome Browser
Species Human (GRCh38)
Location 5:3029672-3029694
Sequence ACACCTGCACAGTCCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927552_985927563 8 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data
985927552_985927568 28 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927568 5:3029723-3029745 CGGCTGGTGTGGGAGTGTGGAGG No data
985927552_985927560 3 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927560 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
985927552_985927567 25 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927567 5:3029720-3029742 GGGCGGCTGGTGTGGGAGTGTGG No data
985927552_985927561 4 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data
985927552_985927562 5 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927562 5:3029700-3029722 AGGTGGGCGTCAAAGGCGAGGGG No data
985927552_985927565 17 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927552_985927564 12 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927564 5:3029707-3029729 CGTCAAAGGCGAGGGGCGGCTGG No data
985927552_985927570 30 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927570 5:3029725-3029747 GCTGGTGTGGGAGTGTGGAGGGG No data
985927552_985927566 18 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927552_985927569 29 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927569 5:3029724-3029746 GGCTGGTGTGGGAGTGTGGAGGG No data
985927552_985927557 -2 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927557 5:3029693-3029715 GTCCACCAGGTGGGCGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927552 Original CRISPR ACACCTGCACAGTCCTCCCA GGG (reversed) Intergenic