ID: 985927553

View in Genome Browser
Species Human (GRCh38)
Location 5:3029673-3029695
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927553_985927567 24 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927567 5:3029720-3029742 GGGCGGCTGGTGTGGGAGTGTGG No data
985927553_985927566 17 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927553_985927562 4 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927562 5:3029700-3029722 AGGTGGGCGTCAAAGGCGAGGGG No data
985927553_985927568 27 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927568 5:3029723-3029745 CGGCTGGTGTGGGAGTGTGGAGG No data
985927553_985927564 11 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927564 5:3029707-3029729 CGTCAAAGGCGAGGGGCGGCTGG No data
985927553_985927569 28 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927569 5:3029724-3029746 GGCTGGTGTGGGAGTGTGGAGGG No data
985927553_985927571 30 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927571 5:3029726-3029748 CTGGTGTGGGAGTGTGGAGGGGG No data
985927553_985927557 -3 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927557 5:3029693-3029715 GTCCACCAGGTGGGCGTCAAAGG 0: 1
1: 0
2: 0
3: 11
4: 68
985927553_985927561 3 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data
985927553_985927570 29 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927570 5:3029725-3029747 GCTGGTGTGGGAGTGTGGAGGGG No data
985927553_985927565 16 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927553_985927560 2 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927560 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG 0: 1
1: 0
2: 0
3: 12
4: 118
985927553_985927563 7 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927553 Original CRISPR GACACCTGCACAGTCCTCCC AGG (reversed) Intergenic