ID: 985927556

View in Genome Browser
Species Human (GRCh38)
Location 5:3029684-3029706
Sequence TGTGCAGGTGTCCACCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927551_985927556 -10 Left 985927551 5:3029671-3029693 CCCCTGGGAGGACTGTGCAGGTG No data
Right 985927556 5:3029684-3029706 TGTGCAGGTGTCCACCAGGTGGG No data
985927547_985927556 3 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927556 5:3029684-3029706 TGTGCAGGTGTCCACCAGGTGGG No data
985927544_985927556 27 Left 985927544 5:3029634-3029656 CCGGGAATGGTGCAAGGTGCTCA No data
Right 985927556 5:3029684-3029706 TGTGCAGGTGTCCACCAGGTGGG No data
985927550_985927556 -9 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927556 5:3029684-3029706 TGTGCAGGTGTCCACCAGGTGGG No data
985927543_985927556 28 Left 985927543 5:3029633-3029655 CCCGGGAATGGTGCAAGGTGCTC No data
Right 985927556 5:3029684-3029706 TGTGCAGGTGTCCACCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927556 Original CRISPR TGTGCAGGTGTCCACCAGGT GGG Intergenic