ID: 985927558

View in Genome Browser
Species Human (GRCh38)
Location 5:3029695-3029717
Sequence CGCCTTTGACGCCCACCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927558_985927568 5 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927568 5:3029723-3029745 CGGCTGGTGTGGGAGTGTGGAGG No data
985927558_985927567 2 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927567 5:3029720-3029742 GGGCGGCTGGTGTGGGAGTGTGG No data
985927558_985927573 29 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927573 5:3029747-3029769 GGCCATGCAGGAGTTGCTCCTGG No data
985927558_985927572 17 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927572 5:3029735-3029757 GAGTGTGGAGGGGGCCATGCAGG No data
985927558_985927565 -6 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927558_985927571 8 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927571 5:3029726-3029748 CTGGTGTGGGAGTGTGGAGGGGG No data
985927558_985927570 7 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927570 5:3029725-3029747 GCTGGTGTGGGAGTGTGGAGGGG No data
985927558_985927566 -5 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927558_985927569 6 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927569 5:3029724-3029746 GGCTGGTGTGGGAGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927558 Original CRISPR CGCCTTTGACGCCCACCTGG TGG (reversed) Intergenic
No off target data available for this crispr