ID: 985927561

View in Genome Browser
Species Human (GRCh38)
Location 5:3029699-3029721
Sequence CAGGTGGGCGTCAAAGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927547_985927561 18 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data
985927553_985927561 3 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data
985927550_985927561 6 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data
985927551_985927561 5 Left 985927551 5:3029671-3029693 CCCCTGGGAGGACTGTGCAGGTG No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data
985927552_985927561 4 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927561 5:3029699-3029721 CAGGTGGGCGTCAAAGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927561 Original CRISPR CAGGTGGGCGTCAAAGGCGA GGG Intergenic