ID: 985927563

View in Genome Browser
Species Human (GRCh38)
Location 5:3029703-3029725
Sequence TGGGCGTCAAAGGCGAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927547_985927563 22 Left 985927547 5:3029658-3029680 CCGAGAACTGTTCCCCCTGGGAG No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data
985927552_985927563 8 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data
985927553_985927563 7 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data
985927551_985927563 9 Left 985927551 5:3029671-3029693 CCCCTGGGAGGACTGTGCAGGTG No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data
985927550_985927563 10 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927563 5:3029703-3029725 TGGGCGTCAAAGGCGAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927563 Original CRISPR TGGGCGTCAAAGGCGAGGGG CGG Intergenic