ID: 985927565

View in Genome Browser
Species Human (GRCh38)
Location 5:3029712-3029734
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927558_985927565 -6 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927553_985927565 16 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927559_985927565 -9 Left 985927559 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927551_985927565 18 Left 985927551 5:3029671-3029693 CCCCTGGGAGGACTGTGCAGGTG No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927550_985927565 19 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data
985927552_985927565 17 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927565 5:3029712-3029734 AAGGCGAGGGGCGGCTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type