ID: 985927566

View in Genome Browser
Species Human (GRCh38)
Location 5:3029713-3029735
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927551_985927566 19 Left 985927551 5:3029671-3029693 CCCCTGGGAGGACTGTGCAGGTG No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927559_985927566 -8 Left 985927559 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927552_985927566 18 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927558_985927566 -5 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927550_985927566 20 Left 985927550 5:3029670-3029692 CCCCCTGGGAGGACTGTGCAGGT No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data
985927553_985927566 17 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927566 5:3029713-3029735 AGGCGAGGGGCGGCTGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type