ID: 985927569

View in Genome Browser
Species Human (GRCh38)
Location 5:3029724-3029746
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927551_985927569 30 Left 985927551 5:3029671-3029693 CCCCTGGGAGGACTGTGCAGGTG No data
Right 985927569 5:3029724-3029746 GGCTGGTGTGGGAGTGTGGAGGG No data
985927558_985927569 6 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927569 5:3029724-3029746 GGCTGGTGTGGGAGTGTGGAGGG No data
985927552_985927569 29 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927569 5:3029724-3029746 GGCTGGTGTGGGAGTGTGGAGGG No data
985927553_985927569 28 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927569 5:3029724-3029746 GGCTGGTGTGGGAGTGTGGAGGG No data
985927559_985927569 3 Left 985927559 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
Right 985927569 5:3029724-3029746 GGCTGGTGTGGGAGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type