ID: 985927570

View in Genome Browser
Species Human (GRCh38)
Location 5:3029725-3029747
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927558_985927570 7 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927570 5:3029725-3029747 GCTGGTGTGGGAGTGTGGAGGGG No data
985927559_985927570 4 Left 985927559 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
Right 985927570 5:3029725-3029747 GCTGGTGTGGGAGTGTGGAGGGG No data
985927553_985927570 29 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927570 5:3029725-3029747 GCTGGTGTGGGAGTGTGGAGGGG No data
985927552_985927570 30 Left 985927552 5:3029672-3029694 CCCTGGGAGGACTGTGCAGGTGT No data
Right 985927570 5:3029725-3029747 GCTGGTGTGGGAGTGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type