ID: 985927571

View in Genome Browser
Species Human (GRCh38)
Location 5:3029726-3029748
Sequence CTGGTGTGGGAGTGTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927553_985927571 30 Left 985927553 5:3029673-3029695 CCTGGGAGGACTGTGCAGGTGTC No data
Right 985927571 5:3029726-3029748 CTGGTGTGGGAGTGTGGAGGGGG No data
985927558_985927571 8 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927571 5:3029726-3029748 CTGGTGTGGGAGTGTGGAGGGGG No data
985927559_985927571 5 Left 985927559 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
Right 985927571 5:3029726-3029748 CTGGTGTGGGAGTGTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927571 Original CRISPR CTGGTGTGGGAGTGTGGAGG GGG Intergenic
No off target data available for this crispr