ID: 985927572

View in Genome Browser
Species Human (GRCh38)
Location 5:3029735-3029757
Sequence GAGTGTGGAGGGGGCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927558_985927572 17 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927572 5:3029735-3029757 GAGTGTGGAGGGGGCCATGCAGG No data
985927559_985927572 14 Left 985927559 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
Right 985927572 5:3029735-3029757 GAGTGTGGAGGGGGCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985927572 Original CRISPR GAGTGTGGAGGGGGCCATGC AGG Intergenic
No off target data available for this crispr