ID: 985927573

View in Genome Browser
Species Human (GRCh38)
Location 5:3029747-3029769
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985927559_985927573 26 Left 985927559 5:3029698-3029720 CCAGGTGGGCGTCAAAGGCGAGG No data
Right 985927573 5:3029747-3029769 GGCCATGCAGGAGTTGCTCCTGG No data
985927558_985927573 29 Left 985927558 5:3029695-3029717 CCACCAGGTGGGCGTCAAAGGCG No data
Right 985927573 5:3029747-3029769 GGCCATGCAGGAGTTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type