ID: 985927573 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:3029747-3029769 |
Sequence | GGCCATGCAGGAGTTGCTCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
985927559_985927573 | 26 | Left | 985927559 | 5:3029698-3029720 | CCAGGTGGGCGTCAAAGGCGAGG | No data | ||
Right | 985927573 | 5:3029747-3029769 | GGCCATGCAGGAGTTGCTCCTGG | No data | ||||
985927558_985927573 | 29 | Left | 985927558 | 5:3029695-3029717 | CCACCAGGTGGGCGTCAAAGGCG | No data | ||
Right | 985927573 | 5:3029747-3029769 | GGCCATGCAGGAGTTGCTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
985927573 | Original CRISPR | GGCCATGCAGGAGTTGCTCC TGG | Intergenic | ||