ID: 985930091

View in Genome Browser
Species Human (GRCh38)
Location 5:3050320-3050342
Sequence CTGTATGATTCCTGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985930085_985930091 -4 Left 985930085 5:3050301-3050323 CCGGGCTCCAGGGACCACACTGT No data
Right 985930091 5:3050320-3050342 CTGTATGATTCCTGGGAAATGGG No data
985930080_985930091 15 Left 985930080 5:3050282-3050304 CCTTGTGCAAATGAGGCAGCCGG No data
Right 985930091 5:3050320-3050342 CTGTATGATTCCTGGGAAATGGG No data
985930079_985930091 16 Left 985930079 5:3050281-3050303 CCCTTGTGCAAATGAGGCAGCCG No data
Right 985930091 5:3050320-3050342 CTGTATGATTCCTGGGAAATGGG No data
985930077_985930091 23 Left 985930077 5:3050274-3050296 CCACATGCCCTTGTGCAAATGAG No data
Right 985930091 5:3050320-3050342 CTGTATGATTCCTGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985930091 Original CRISPR CTGTATGATTCCTGGGAAAT GGG Intergenic
No off target data available for this crispr