ID: 985930789

View in Genome Browser
Species Human (GRCh38)
Location 5:3056093-3056115
Sequence AAGGGAAGTCCAGTGACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985930789_985930790 -9 Left 985930789 5:3056093-3056115 CCGGCAGTCACTGGACTTCCCTT No data
Right 985930790 5:3056107-3056129 ACTTCCCTTCCAGACTCTGTTGG No data
985930789_985930795 26 Left 985930789 5:3056093-3056115 CCGGCAGTCACTGGACTTCCCTT No data
Right 985930795 5:3056142-3056164 AGCCCAGAGGCTGCTCACAGAGG No data
985930789_985930794 13 Left 985930789 5:3056093-3056115 CCGGCAGTCACTGGACTTCCCTT No data
Right 985930794 5:3056129-3056151 GAAAATATCACAAAGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985930789 Original CRISPR AAGGGAAGTCCAGTGACTGC CGG (reversed) Intergenic
No off target data available for this crispr