ID: 985931897

View in Genome Browser
Species Human (GRCh38)
Location 5:3064814-3064836
Sequence GCTCTGACACACCAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985931887_985931897 22 Left 985931887 5:3064769-3064791 CCCCGGGGATCAGAAACGGCCCG No data
Right 985931897 5:3064814-3064836 GCTCTGACACACCAGCAGAGTGG No data
985931894_985931897 -6 Left 985931894 5:3064797-3064819 CCAGGCACCGTGAGCCAGCTCTG No data
Right 985931897 5:3064814-3064836 GCTCTGACACACCAGCAGAGTGG No data
985931892_985931897 3 Left 985931892 5:3064788-3064810 CCCGTGGATCCAGGCACCGTGAG No data
Right 985931897 5:3064814-3064836 GCTCTGACACACCAGCAGAGTGG No data
985931893_985931897 2 Left 985931893 5:3064789-3064811 CCGTGGATCCAGGCACCGTGAGC No data
Right 985931897 5:3064814-3064836 GCTCTGACACACCAGCAGAGTGG No data
985931889_985931897 20 Left 985931889 5:3064771-3064793 CCGGGGATCAGAAACGGCCCGTG No data
Right 985931897 5:3064814-3064836 GCTCTGACACACCAGCAGAGTGG No data
985931888_985931897 21 Left 985931888 5:3064770-3064792 CCCGGGGATCAGAAACGGCCCGT No data
Right 985931897 5:3064814-3064836 GCTCTGACACACCAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985931897 Original CRISPR GCTCTGACACACCAGCAGAG TGG Intergenic
No off target data available for this crispr