ID: 985932799

View in Genome Browser
Species Human (GRCh38)
Location 5:3072318-3072340
Sequence ACATTAATACTGTTGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985932799_985932802 -1 Left 985932799 5:3072318-3072340 CCCTGATCCAACAGTATTAATGT No data
Right 985932802 5:3072340-3072362 TCCTATGTCCTTCTAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985932799 Original CRISPR ACATTAATACTGTTGGATCA GGG (reversed) Intergenic
No off target data available for this crispr