ID: 985933479

View in Genome Browser
Species Human (GRCh38)
Location 5:3077713-3077735
Sequence GAGTGGGAAAGGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985933469_985933479 12 Left 985933469 5:3077678-3077700 CCCTGTGAAGCACGAGGTCGTCT No data
Right 985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG No data
985933470_985933479 11 Left 985933470 5:3077679-3077701 CCTGTGAAGCACGAGGTCGTCTG No data
Right 985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG No data
985933467_985933479 30 Left 985933467 5:3077660-3077682 CCAGAAGAAGGATTTAAACCCTG No data
Right 985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985933479 Original CRISPR GAGTGGGAAAGGAGGGAGGC TGG Intergenic
No off target data available for this crispr