ID: 985933671

View in Genome Browser
Species Human (GRCh38)
Location 5:3078653-3078675
Sequence GGATCTACTAAGTGTCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985933664_985933671 3 Left 985933664 5:3078627-3078649 CCGCGTGTCTGGAGGGATCCACA No data
Right 985933671 5:3078653-3078675 GGATCTACTAAGTGTCAGTAGGG No data
985933663_985933671 6 Left 985933663 5:3078624-3078646 CCGCCGCGTGTCTGGAGGGATCC No data
Right 985933671 5:3078653-3078675 GGATCTACTAAGTGTCAGTAGGG No data
985933659_985933671 18 Left 985933659 5:3078612-3078634 CCACAGGGGACTCCGCCGCGTGT No data
Right 985933671 5:3078653-3078675 GGATCTACTAAGTGTCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985933671 Original CRISPR GGATCTACTAAGTGTCAGTA GGG Intergenic
No off target data available for this crispr