ID: 985936166

View in Genome Browser
Species Human (GRCh38)
Location 5:3100188-3100210
Sequence GGCACACTCGTTGTTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985936166_985936172 10 Left 985936166 5:3100188-3100210 CCAGGGGGAACAACGAGTGTGCC No data
Right 985936172 5:3100221-3100243 GGTGCGTGCCCTCTCACCTAAGG No data
985936166_985936176 29 Left 985936166 5:3100188-3100210 CCAGGGGGAACAACGAGTGTGCC No data
Right 985936176 5:3100240-3100262 AAGGAACCACCTGTAGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985936166 Original CRISPR GGCACACTCGTTGTTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr