ID: 985936552

View in Genome Browser
Species Human (GRCh38)
Location 5:3101952-3101974
Sequence CTGTGTGTTCTCTGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985936552_985936558 13 Left 985936552 5:3101952-3101974 CCATCTTCACAGAGAACACACAG No data
Right 985936558 5:3101988-3102010 AGACAGGAAAGGGCAAGCATTGG No data
985936552_985936559 14 Left 985936552 5:3101952-3101974 CCATCTTCACAGAGAACACACAG No data
Right 985936559 5:3101989-3102011 GACAGGAAAGGGCAAGCATTGGG No data
985936552_985936555 2 Left 985936552 5:3101952-3101974 CCATCTTCACAGAGAACACACAG No data
Right 985936555 5:3101977-3101999 AACCAGGAGACAGACAGGAAAGG No data
985936552_985936561 27 Left 985936552 5:3101952-3101974 CCATCTTCACAGAGAACACACAG No data
Right 985936561 5:3102002-3102024 AAGCATTGGGAAATAAAAGAGGG No data
985936552_985936562 28 Left 985936552 5:3101952-3101974 CCATCTTCACAGAGAACACACAG No data
Right 985936562 5:3102003-3102025 AGCATTGGGAAATAAAAGAGGGG No data
985936552_985936554 -3 Left 985936552 5:3101952-3101974 CCATCTTCACAGAGAACACACAG No data
Right 985936554 5:3101972-3101994 CAGCAAACCAGGAGACAGACAGG No data
985936552_985936556 3 Left 985936552 5:3101952-3101974 CCATCTTCACAGAGAACACACAG No data
Right 985936556 5:3101978-3102000 ACCAGGAGACAGACAGGAAAGGG No data
985936552_985936560 26 Left 985936552 5:3101952-3101974 CCATCTTCACAGAGAACACACAG No data
Right 985936560 5:3102001-3102023 CAAGCATTGGGAAATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985936552 Original CRISPR CTGTGTGTTCTCTGTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr