ID: 985937749

View in Genome Browser
Species Human (GRCh38)
Location 5:3109760-3109782
Sequence ACAGCCTGTCTGGGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985937741_985937749 28 Left 985937741 5:3109709-3109731 CCTCCATGGTGAATCTGGGGGTC No data
Right 985937749 5:3109760-3109782 ACAGCCTGTCTGGGAAAAGCTGG No data
985937742_985937749 25 Left 985937742 5:3109712-3109734 CCATGGTGAATCTGGGGGTCACA No data
Right 985937749 5:3109760-3109782 ACAGCCTGTCTGGGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985937749 Original CRISPR ACAGCCTGTCTGGGAAAAGC TGG Intergenic
No off target data available for this crispr