ID: 985945375

View in Genome Browser
Species Human (GRCh38)
Location 5:3178033-3178055
Sequence CTTCATAAACACATGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985945370_985945375 12 Left 985945370 5:3177998-3178020 CCGTCAGGTCCCTGGGGCTTGGA 0: 1
1: 0
2: 0
3: 37
4: 229
Right 985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG 0: 1
1: 0
2: 0
3: 23
4: 250
985945372_985945375 2 Left 985945372 5:3178008-3178030 CCTGGGGCTTGGAACTAAGTAGC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG 0: 1
1: 0
2: 0
3: 23
4: 250
985945365_985945375 21 Left 985945365 5:3177989-3178011 CCGAGCTCACCGTCAGGTCCCTG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG 0: 1
1: 0
2: 0
3: 23
4: 250
985945371_985945375 3 Left 985945371 5:3178007-3178029 CCCTGGGGCTTGGAACTAAGTAG 0: 1
1: 0
2: 1
3: 12
4: 107
Right 985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG 0: 1
1: 0
2: 0
3: 23
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985945375 Original CRISPR CTTCATAAACACATGGATTT TGG Intergenic
901557794 1:10045284-10045306 CTTCACACACTTATGGATTTCGG - Intronic
903403617 1:23077740-23077762 ATTCATAAATACCAGGATTTTGG + Intronic
903443315 1:23404487-23404509 CTTTCTAAAAACATGCATTTTGG + Intronic
903690118 1:25167443-25167465 CTTCAGAAAGACATGGCATTAGG - Intergenic
905032401 1:34895580-34895602 TTGCATATACACATGGATTTTGG - Intronic
908326925 1:63032048-63032070 CTCTATTAACACCTGGATTTTGG + Intergenic
908483716 1:64569758-64569780 CTTGAAAAAAACATGGATCTGGG + Intronic
911675935 1:100658219-100658241 CTTTATAAAAACATGGACTAGGG - Intergenic
913221765 1:116666183-116666205 TTTCATCAACACTAGGATTTGGG - Intronic
913684276 1:121216573-121216595 CTTCATGTATACATGGGTTTGGG + Intronic
914036115 1:144004188-144004210 CTTCATGTATACATGGGTTTGGG + Intergenic
914153343 1:145063757-145063779 CTTCATGTATACATGGGTTTGGG - Intronic
920471581 1:206235065-206235087 CTTCATGTATACATGGGTTTGGG + Intronic
923542547 1:234898956-234898978 CCTCAAAATCACATGGATTGGGG - Intergenic
924086176 1:240454238-240454260 CTTCATTAAGATATGGCTTTGGG + Intronic
924374168 1:243388431-243388453 CTTCAGAACCACATGGAATAAGG + Intronic
1062966590 10:1611989-1612011 CTTCAGAATCACAAGGAATTAGG + Intronic
1062970202 10:1642204-1642226 CTTCAAAAGCACACGGATTTTGG + Intronic
1063102086 10:2959124-2959146 ATTCATAAAAACATGCATATGGG - Intergenic
1064889492 10:20154070-20154092 TTTCTTAAATACATGGAGTTTGG + Intronic
1065582256 10:27183609-27183631 CTTGATAAAGAAATGCATTTTGG - Intronic
1067043084 10:42968516-42968538 CTTCATAAAAACAAAAATTTAGG - Intergenic
1067310743 10:45111499-45111521 CTTCAGCAACACATGGGTTGAGG - Intergenic
1068863051 10:61867100-61867122 TTTCATAAACACCTAGACTTTGG + Intergenic
1069049784 10:63780452-63780474 CTGCATAAACCCAGGGGTTTGGG + Intergenic
1071894873 10:90055263-90055285 ATTCAGAAGCAAATGGATTTGGG - Intergenic
1072338098 10:94418295-94418317 CTACCTAAACATATAGATTTTGG + Intronic
1072778448 10:98224849-98224871 CTTAAGAATCACATGTATTTGGG - Intronic
1072988905 10:100170640-100170662 TTTTATTAATACATGGATTTTGG + Intronic
1075120912 10:119664031-119664053 CTTCCGTAACACATGTATTTAGG + Intronic
1075756554 10:124816718-124816740 CTCAATAAATACATGGATTTGGG - Intronic
1075912872 10:126141069-126141091 GTTCACAAACACTTGGTTTTTGG + Intronic
1077476114 11:2791389-2791411 CCTCAGAAAAACATGTATTTTGG + Intronic
1077654845 11:4008989-4009011 CTTCATAAAAAGTTGCATTTTGG + Intronic
1078253919 11:9641132-9641154 CTTCTTAGACACTTGGATTCTGG - Intergenic
1084362625 11:68678675-68678697 CTACGAAAACACATGGACTTAGG + Intergenic
1085196709 11:74677028-74677050 ATTCATAAAGTCATGGATTATGG + Intergenic
1087263928 11:96041124-96041146 CATTCTGAACACATGGATTTTGG + Intronic
1090070385 11:123539299-123539321 CTTCTTCAACACCTGAATTTGGG + Intronic
1090315214 11:125780495-125780517 CTTCTTAAACACATGAAATATGG + Intergenic
1092049895 12:5461025-5461047 CTTTCTAACCACTTGGATTTGGG + Intronic
1092985462 12:13840965-13840987 CTTAATAAACACATGGCTATAGG - Intronic
1093532240 12:20180763-20180785 CTTCATTAACCCATGAGTTTTGG + Intergenic
1093783497 12:23165404-23165426 CTTCATGAACAAAGGTATTTAGG + Intergenic
1094280976 12:28737733-28737755 TTTCCTAAACACAGGCATTTAGG - Intergenic
1097485583 12:60194665-60194687 CTGTATAAACACATACATTTAGG + Intergenic
1098417406 12:70251067-70251089 CTACATAAACACATGAATTAAGG - Intronic
1098468927 12:70821962-70821984 CTTAATAAATACATAGGTTTCGG - Intronic
1098643571 12:72868968-72868990 CTATCTAAACACATGGATTAAGG - Intergenic
1099313223 12:81053637-81053659 ATTCATACACACATGTATATAGG + Intronic
1099333405 12:81321817-81321839 ATTCAGAAACACAGGAATTTTGG + Intronic
1099802636 12:87475499-87475521 CTTCACAAACTCATGTATTTAGG - Intergenic
1100323565 12:93519775-93519797 CTGGATAAACACAAGGATTAGGG - Intergenic
1103127595 12:118437549-118437571 CTTCAGATACACATGGATATTGG - Intergenic
1103845366 12:123898467-123898489 CTTCAGAAATACATTCATTTTGG + Intronic
1106726187 13:32488088-32488110 ATTAATAAACACATGGAACTAGG + Intronic
1109091996 13:58059388-58059410 CTTGATAAACACATGACTTGAGG + Intergenic
1109731112 13:66415347-66415369 TTTCAGGAACAGATGGATTTTGG - Intronic
1109896608 13:68699965-68699987 TTTCATAAACAGCTGGATATGGG + Intergenic
1110366337 13:74690210-74690232 CCTCATAAATACCTGGATTCAGG + Intergenic
1111119856 13:83832578-83832600 CTTCATAAATGGAAGGATTTTGG + Intergenic
1111206380 13:85017054-85017076 GTTAATAAAGACTTGGATTTGGG + Intergenic
1112068997 13:95827230-95827252 TTTCAAAAATACATGAATTTTGG + Intronic
1112248932 13:97760651-97760673 CTTTAGAAACACATCTATTTAGG + Intergenic
1112785493 13:102947037-102947059 CTTATTAACCACATGCATTTGGG + Intergenic
1112816441 13:103279017-103279039 CTTCATCAAAACATGTCTTTTGG + Intergenic
1112917772 13:104572328-104572350 CTTCAAAAATACTTGGATTCCGG - Intergenic
1113196730 13:107816951-107816973 CTTTTTATACATATGGATTTTGG + Intronic
1115186943 14:30699652-30699674 CTTCAGAAACATGTGTATTTAGG + Intronic
1118508220 14:66440320-66440342 CTTCTAAAACACATGGAGATAGG + Intergenic
1118953240 14:70454282-70454304 TTTCACAAACACATTGGTTTTGG + Intronic
1119011412 14:70993480-70993502 GTTTATAATCACATGGATTCTGG + Intronic
1120676104 14:87423197-87423219 CATCCTAAAAAAATGGATTTGGG - Intergenic
1121026961 14:90623374-90623396 TTTCTTATTCACATGGATTTGGG - Intronic
1121810315 14:96881435-96881457 CATCACAAACACACGGCTTTGGG - Exonic
1122919140 14:104872898-104872920 CGCCCCAAACACATGGATTTTGG - Intronic
1123507099 15:20953874-20953896 GTGTATAAACACATGGCTTTGGG - Intergenic
1123564326 15:21527617-21527639 GTGTATAAACACATGGCTTTGGG - Intergenic
1123600579 15:21964900-21964922 GTGTATAAACACATGGCTTTGGG - Intergenic
1125553318 15:40564416-40564438 TTTGATAAAAACATGGATTCTGG - Intronic
1126259458 15:46671111-46671133 CTGCATAAAAACATAGTTTTTGG - Intergenic
1126422619 15:48490698-48490720 CTTTATAATCCCATGAATTTGGG - Intronic
1127701573 15:61506437-61506459 CAACATAAGCACATGCATTTAGG - Intergenic
1128822458 15:70671825-70671847 CTTCATCAGCACATGGAACTAGG - Intronic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1130677565 15:85967194-85967216 CCTCACAAACACATGGAGTAGGG - Intergenic
1131620736 15:94065605-94065627 CTTCATTAACACATGGGATGTGG + Intergenic
1132427640 15:101732199-101732221 CTTCCTAAGCACCTGGATGTTGG - Intergenic
1202972687 15_KI270727v1_random:254725-254747 GTGTATAAACACATGGCTTTGGG - Intergenic
1134797739 16:17057068-17057090 CCTCATAATCCCATGGATCTAGG - Intergenic
1136005772 16:27327661-27327683 GTCCTTAAACACGTGGATTTTGG + Intronic
1136034133 16:27525999-27526021 CTTCCAAAACACAGGGCTTTGGG - Intronic
1137520478 16:49191015-49191037 CTTCAGATACAAATGGATTCAGG + Intergenic
1137663336 16:50229076-50229098 GTTCTCAAACACCTGGATTTGGG - Intronic
1138071768 16:53999412-53999434 CTTAACAAACACTGGGATTTGGG + Intronic
1139892093 16:70259744-70259766 ATTTATAAACACATACATTTGGG - Intronic
1140295927 16:73709879-73709901 CATCATAAATACATAGGTTTTGG + Intergenic
1140650116 16:77079062-77079084 CTTCAAATCCACATGGATTGAGG - Intergenic
1140678569 16:77360687-77360709 CTTCAAAAACACAATGATTTTGG - Intronic
1143643213 17:8211696-8211718 CTTCATCAACCTAGGGATTTGGG - Intergenic
1144932862 17:18874256-18874278 CTTCATACACAGAAGCATTTAGG - Intronic
1145368190 17:22282758-22282780 CTTCATAAATGCATGAATTTGGG - Intergenic
1148075092 17:44931172-44931194 CTTCATCAACAGATTGATTGCGG - Intronic
1149180951 17:53935334-53935356 CTTCAGGAACACCTTGATTTAGG - Intergenic
1149543926 17:57489221-57489243 TTTCATAAACTCATGGAAGTGGG - Intronic
1149610072 17:57953613-57953635 CTCCCTACACACATGCATTTTGG + Intronic
1154145579 18:11863621-11863643 CCTTAAAATCACATGGATTTGGG + Intronic
1155522380 18:26681759-26681781 CCTCATAAAAACATGGCTCTAGG - Intergenic
1155748057 18:29385717-29385739 CTTCATTAACACAGGGCTGTGGG + Intergenic
1156318492 18:35994529-35994551 CTTCATAAGCAGGTGGATATCGG + Intronic
1158061055 18:53342681-53342703 CTACATATACATATGTATTTAGG - Intronic
1158130454 18:54147245-54147267 CTTCTTAAAAGAATGGATTTGGG - Intergenic
1158202307 18:54954437-54954459 TTCTATAAACACCTGGATTTTGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158256352 18:55553568-55553590 ATACATAAACACAGGGAGTTGGG - Intronic
1159519578 18:69500899-69500921 ATTTATAAACACATGTATTTTGG + Intronic
1160358951 18:78254004-78254026 CTTCATAAATAAATGTATATAGG - Intergenic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1166809812 19:45508300-45508322 CTTCTTAATCCCCTGGATTTTGG + Intronic
926811063 2:16755768-16755790 CTTCATAATCACATTTTTTTCGG + Intergenic
927229362 2:20805334-20805356 CTTTATAAATACATGGAATTAGG - Intronic
929477547 2:42267019-42267041 ATGTTTAAACACATGGATTTTGG + Intronic
935662194 2:105476616-105476638 GGACATGAACACATGGATTTTGG + Intergenic
936780467 2:116026905-116026927 CTTGATAAACTCATGTATTTTGG - Intergenic
938158144 2:128958851-128958873 CTACTTTAACATATGGATTTAGG - Intergenic
939841494 2:147194562-147194584 CTTGATAAAAACATTGAGTTTGG - Intergenic
940018197 2:149129189-149129211 TGTCCTAAACATATGGATTTTGG - Intronic
940419508 2:153463272-153463294 CCTAATACACACTTGGATTTGGG - Intergenic
940788222 2:158004717-158004739 CTTCATAAAGAAATGCAATTTGG + Intronic
941475056 2:165940778-165940800 CTTCATGACCACAGGGATATTGG + Intronic
943094754 2:183416031-183416053 CTTCAGAAATACATGTATTATGG - Intergenic
944714042 2:202361404-202361426 TTTCTTAAAGACATTGATTTTGG + Intergenic
946100833 2:217320226-217320248 TTACATAAATACATGGAGTTAGG - Intronic
946524697 2:220505873-220505895 CTTTGTAACCACATGAATTTGGG + Intergenic
946533737 2:220604622-220604644 CTTCAACAACATATGAATTTTGG + Intergenic
1168862641 20:1056880-1056902 CCTCTGAAACACATGGATCTGGG - Intergenic
1168946917 20:1768608-1768630 CTTCATAAAGACAATGAATTAGG + Intergenic
1170254738 20:14327786-14327808 TTTCAAAATCAAATGGATTTAGG - Intronic
1172096404 20:32462604-32462626 CTTAAAAAAAAAATGGATTTAGG + Intronic
1173742369 20:45410041-45410063 CTCCATCATCACTTGGATTTGGG - Exonic
1178835011 21:36089553-36089575 CTTCATAAAGACTTGTATTTGGG - Intergenic
1179074038 21:38101194-38101216 CTTCAGATACACATGGAAATGGG + Intronic
1183154968 22:36067688-36067710 CTCCATATATACATGTATTTGGG - Intergenic
1185153750 22:49180850-49180872 CCTGATAAACACAAGGACTTTGG - Intergenic
1185356424 22:50374569-50374591 ATTCCTAAACCTATGGATTTAGG - Intronic
949506881 3:4736980-4737002 TTTCATAAACCAATGGATTCAGG + Intronic
949775757 3:7630749-7630771 GATCATAGACAAATGGATTTGGG + Intronic
951938472 3:28050846-28050868 GTTCAAAAACAAATGGCTTTAGG - Intergenic
952068143 3:29597179-29597201 CTTTAAAAAAACATGTATTTTGG - Intronic
952808637 3:37381476-37381498 CCTCATTAACACCTGGAGTTGGG + Intergenic
954512543 3:51139023-51139045 CTTCATCCACACATTCATTTAGG + Intronic
954731650 3:52667993-52668015 GTTCATAATCACATGAATGTGGG + Intronic
955337299 3:58097393-58097415 ATTCTTAGATACATGGATTTGGG - Intronic
957341700 3:78907006-78907028 CTTCATAAAGACATCGAGTTGGG + Intronic
958945915 3:100361843-100361865 CTTCATATACACACAAATTTTGG - Intergenic
959167843 3:102802795-102802817 CTACATTTACACATGGATTGAGG + Intergenic
959195913 3:103181699-103181721 TTTAATCAACACATGAATTTGGG - Intergenic
960922354 3:122760230-122760252 CTGTTTAATCACATGGATTTGGG - Intronic
962747636 3:138409147-138409169 CTTCTCAAACACTTGCATTTTGG + Intergenic
964559871 3:157982387-157982409 CTTAGTAAACACATGGTATTAGG + Intergenic
966159208 3:176950291-176950313 AAACATAAACACATGAATTTGGG + Intergenic
966260069 3:177965949-177965971 GTTCATGAACTCATAGATTTAGG + Intergenic
966990198 3:185222004-185222026 CTACATAAACACAAGCTTTTTGG - Intronic
968217229 3:196903391-196903413 CTTCATAAAAACAATGATTGAGG - Intronic
968714010 4:2141233-2141255 CTGCCTGAACACATGGATTGTGG + Intronic
968837767 4:2977972-2977994 CTTCATAAGCCCATGGAATGGGG - Intronic
969178493 4:5418978-5419000 CTTCATGAACACTAGGTTTTTGG + Intronic
969614929 4:8246772-8246794 CTTAATAAACACGTGAATTGAGG + Intergenic
970616621 4:17773956-17773978 CTTCATTAACACTTGTGTTTGGG + Intronic
970920848 4:21392992-21393014 CTTTTTAAACACATTGATTTGGG + Intronic
971019186 4:22516550-22516572 CTTCCGAAACACTTGGTTTTGGG - Intergenic
972060376 4:34862942-34862964 CTTCAAAAACACATAAATTTAGG + Intergenic
972325098 4:38007806-38007828 CTCCATAATGAAATGGATTTGGG + Intronic
972381731 4:38525855-38525877 TTTCATAAAAGCAGGGATTTGGG + Intergenic
972758416 4:42076167-42076189 CTTAATAAAAAAATGGATTCTGG - Intronic
974050082 4:56932714-56932736 CGTCATAAAAACAGTGATTTTGG + Exonic
975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG + Intergenic
976106874 4:81628476-81628498 CTTCATAATCACATCGTTTGTGG + Intronic
976542150 4:86290604-86290626 ATACATAAACACAGGGTTTTGGG + Intronic
977241990 4:94583548-94583570 CTTCATAAACACACTGCCTTTGG - Intronic
978349765 4:107809302-107809324 CTGCTGAAAAACATGGATTTGGG + Intergenic
978509517 4:109500989-109501011 CTTTATAAACACACACATTTAGG - Intronic
979901451 4:126224194-126224216 CTTAATAAAAACTAGGATTTAGG - Intergenic
980922332 4:139099474-139099496 CTTCCTAAATACATGAATTCAGG + Intronic
981234640 4:142400957-142400979 CTTCACAAACCCAAGAATTTAGG + Intronic
981250957 4:142599936-142599958 CTTCAAAAAAACATGTCTTTAGG - Intronic
982703037 4:158677128-158677150 TTTCATCAACACTTGGGTTTAGG - Intronic
983038055 4:162891697-162891719 CTTAAGAAACAAATTGATTTGGG + Intergenic
984595554 4:181663368-181663390 CTCCAAAGGCACATGGATTTGGG + Intergenic
984857029 4:184204245-184204267 GGGCATAAACACATGGGTTTTGG + Intronic
985087793 4:186331694-186331716 CTTGAAGAACACATGTATTTGGG + Intergenic
985897936 5:2760434-2760456 CTTAAGGAACACATGGTTTTGGG - Intergenic
985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG + Intergenic
986508202 5:8474534-8474556 CTTCATACACACTGGTATTTTGG + Intergenic
986734584 5:10659699-10659721 CTTAATAATCACATAGATTATGG - Intergenic
988246561 5:28690544-28690566 ATTCCAAAACACATGGAATTTGG + Intergenic
989520828 5:42397590-42397612 ATTCTGTAACACATGGATTTTGG + Intergenic
989682876 5:44049978-44050000 CTTCATACACACTTGGATAATGG - Intergenic
990050679 5:51495536-51495558 CTTGTTAAACACAAGGATTTTGG - Intergenic
991458669 5:66833343-66833365 CTTCTTGCACACCTGGATTTTGG + Intronic
992296202 5:75329253-75329275 CTTCCAAAGCCCATGGATTTGGG - Intergenic
992809164 5:80369611-80369633 CGTGAAAAACACATGAATTTAGG - Intergenic
994777489 5:104052584-104052606 CTTTATAAAGACATGTCTTTGGG + Intergenic
995090954 5:108176177-108176199 CGTTATAAGCCCATGGATTTAGG - Intronic
996300629 5:121979889-121979911 CTTCATAAACCCATAAATTCTGG + Intronic
997392613 5:133529291-133529313 CTTAATTAAAACATGGATTCTGG - Intronic
1001510459 5:172317205-172317227 CTTAATAAACATATGGATTCAGG - Intergenic
1001787831 5:174428674-174428696 CTTCAGTAATAGATGGATTTGGG + Intergenic
1002950703 6:1807817-1807839 CTTCATAATCATAAGGATTAAGG + Intronic
1005725742 6:28646541-28646563 GTTCAATTACACATGGATTTTGG + Intergenic
1006063303 6:31441958-31441980 GTTCATATCAACATGGATTTTGG - Intergenic
1006525435 6:34600647-34600669 CTTCATAGTCACTTGGGTTTAGG - Intronic
1008729403 6:54462115-54462137 CTTCATATACACAGCAATTTGGG - Intergenic
1010144129 6:72646492-72646514 CTGAAAAACCACATGGATTTGGG + Intronic
1010527307 6:76918249-76918271 CTTGATAAACACCTGAATTTTGG - Intergenic
1012470419 6:99567747-99567769 CTGCTTAAACAAATGTATTTAGG + Intronic
1012911201 6:105119957-105119979 GCCCATAAAAACATGGATTTGGG + Intronic
1014199815 6:118596511-118596533 CTTCAGAAAGACATGAATTAAGG + Intronic
1014923687 6:127244376-127244398 ATTCATAGACACATGGCTCTGGG + Intergenic
1015078899 6:129199118-129199140 TTTTATAAACTGATGGATTTGGG - Intronic
1015301830 6:131661369-131661391 CTTCATCAACACCTGTTTTTGGG + Intronic
1015971730 6:138749229-138749251 TTTGATAAATATATGGATTTTGG - Intergenic
1017411145 6:154168964-154168986 CGTGAGAAACACATGAATTTAGG - Intronic
1018538060 6:164844997-164845019 CACCATAAAAACATGAATTTTGG - Intergenic
1019295919 7:274871-274893 TTTTATGAACAGATGGATTTTGG - Intergenic
1020607009 7:10351798-10351820 GTTAAAAATCACATGGATTTAGG + Intergenic
1023324555 7:39039005-39039027 ATATATAAATACATGGATTTAGG + Intronic
1023432442 7:40108681-40108703 CTTCATAAATACACAGCTTTAGG + Intergenic
1023974448 7:45017642-45017664 CTTCATGAACGCATGTAATTTGG + Intronic
1024736368 7:52309187-52309209 TTTCATAAACACATGCTTTCTGG + Intergenic
1027634276 7:80650509-80650531 TTTCACAAACATATGGGTTTTGG + Intronic
1030870105 7:114745549-114745571 CTTCATAAATTCATTGCTTTAGG + Intergenic
1031801145 7:126247715-126247737 CTTCTTTAACACATGGTTCTGGG - Intergenic
1036110721 8:5898239-5898261 CTTCTTGAACACATGGAATACGG - Intergenic
1037131091 8:15408461-15408483 CTTCATAAATTCATGTATTTTGG - Intergenic
1037236398 8:16724612-16724634 TTACAAAAACACATGTATTTGGG + Intergenic
1038285206 8:26200294-26200316 CTTCATAAGCAGAGGGAATTTGG + Intergenic
1038599223 8:28922081-28922103 CTGCATAAATCCATGGATGTGGG - Intronic
1040864633 8:52036640-52036662 CTTCATAAAAACATCATTTTTGG - Intergenic
1041886098 8:62809538-62809560 CTTCATACACACATGCTTTTGGG - Intronic
1042205939 8:66329710-66329732 CTTTAAAAACACATGGGTCTAGG - Intergenic
1043477588 8:80620217-80620239 CATAATAAACAAATGGAATTTGG - Intergenic
1043687228 8:83102036-83102058 CTTAATAAACACAATGATTATGG - Intergenic
1044531497 8:93312833-93312855 CTTAATAAACATTTGGATTCAGG - Intergenic
1045323020 8:101096166-101096188 CTTTATAAATATATTGATTTCGG - Intergenic
1046794982 8:118361316-118361338 CTCCATAAAAGCATGGATTCAGG + Intronic
1048582708 8:135743495-135743517 CTTCTTAAACTCAAGGATATAGG + Intergenic
1051664392 9:19455117-19455139 ATTCATTAACAAATGAATTTAGG - Intergenic
1051797946 9:20896202-20896224 CACCACAACCACATGGATTTTGG - Intronic
1052169433 9:25375378-25375400 CTACTTATACACATGAATTTTGG - Intergenic
1055471009 9:76610456-76610478 CCTTAAATACACATGGATTTTGG + Intergenic
1056009840 9:82316192-82316214 ATTCTTAAAGATATGGATTTGGG - Intergenic
1056945992 9:90997233-90997255 CTTGACAAACACATGCAGTTTGG - Intergenic
1058778887 9:108313280-108313302 TTTCATAAACACAAGGCTTATGG + Intergenic
1186075900 X:5878112-5878134 ACTCATTAACACATTGATTTTGG + Intronic
1186140779 X:6570803-6570825 ATTCATAAACATATATATTTGGG + Intergenic
1186305746 X:8255726-8255748 CTTCATAAATACATTTATTTTGG - Intergenic
1186922276 X:14295167-14295189 CTTCATAATCCAATGAATTTTGG + Intergenic
1187362461 X:18641329-18641351 CCTCATGAACACAGGGATTGGGG - Exonic
1188665003 X:32808323-32808345 CTTGATAAGCACATGTACTTGGG - Intronic
1191707366 X:64107797-64107819 CTGGATAAACACATGGAATGTGG - Intergenic
1194409615 X:93542017-93542039 CATCTTAAACACATGGACTGAGG - Intergenic
1196934089 X:120712310-120712332 CTTTAAAAATACATTGATTTTGG - Intergenic
1197517593 X:127454252-127454274 ATTTATAAGAACATGGATTTGGG + Intergenic
1197604642 X:128571040-128571062 CTTCAAATACAGATGGATGTGGG - Intergenic
1197662220 X:129186624-129186646 CTCCATAAAAATATGGAATTCGG - Intergenic
1198074814 X:133184244-133184266 GTGCAGAAACACTTGGATTTAGG + Intergenic
1198138864 X:133782694-133782716 CTTCAAATACAAATGAATTTTGG + Intronic
1198420667 X:136468458-136468480 CTGCATCAACATATGAATTTCGG - Intergenic
1201050985 Y:9935091-9935113 CTTCATAGACTCTTGGATTTTGG + Intergenic
1202163282 Y:21957829-21957851 CTTCATAGACTCTTGGATTGTGG + Intergenic
1202228074 Y:22628539-22628561 CTTCATAGACTCTTGGATTGTGG - Intergenic
1202315083 Y:23567637-23567659 CTTCATAGACTCTTGGATTGTGG + Intergenic
1202555718 Y:26102956-26102978 CTTCATAGACTCTTGGATTGTGG - Intergenic