ID: 985947840

View in Genome Browser
Species Human (GRCh38)
Location 5:3200622-3200644
Sequence GGGGAGGAGATACCTACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985947840_985947846 3 Left 985947840 5:3200622-3200644 CCAGATGTAGGTATCTCCTCCCC No data
Right 985947846 5:3200648-3200670 TCCCTTCTGTCTTCAGCAGGTGG No data
985947840_985947851 19 Left 985947840 5:3200622-3200644 CCAGATGTAGGTATCTCCTCCCC No data
Right 985947851 5:3200664-3200686 CAGGTGGATATGCCGGCTCTGGG No data
985947840_985947845 0 Left 985947840 5:3200622-3200644 CCAGATGTAGGTATCTCCTCCCC No data
Right 985947845 5:3200645-3200667 TGCTCCCTTCTGTCTTCAGCAGG No data
985947840_985947849 12 Left 985947840 5:3200622-3200644 CCAGATGTAGGTATCTCCTCCCC No data
Right 985947849 5:3200657-3200679 TCTTCAGCAGGTGGATATGCCGG No data
985947840_985947850 18 Left 985947840 5:3200622-3200644 CCAGATGTAGGTATCTCCTCCCC No data
Right 985947850 5:3200663-3200685 GCAGGTGGATATGCCGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985947840 Original CRISPR GGGGAGGAGATACCTACATC TGG (reversed) Intergenic
No off target data available for this crispr