ID: 985947846

View in Genome Browser
Species Human (GRCh38)
Location 5:3200648-3200670
Sequence TCCCTTCTGTCTTCAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985947839_985947846 6 Left 985947839 5:3200619-3200641 CCACCAGATGTAGGTATCTCCTC No data
Right 985947846 5:3200648-3200670 TCCCTTCTGTCTTCAGCAGGTGG No data
985947840_985947846 3 Left 985947840 5:3200622-3200644 CCAGATGTAGGTATCTCCTCCCC No data
Right 985947846 5:3200648-3200670 TCCCTTCTGTCTTCAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985947846 Original CRISPR TCCCTTCTGTCTTCAGCAGG TGG Intergenic
No off target data available for this crispr