ID: 985948098

View in Genome Browser
Species Human (GRCh38)
Location 5:3202231-3202253
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985948098_985948107 14 Left 985948098 5:3202231-3202253 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948107 5:3202268-3202290 CTCCAGCAATGAGGTCCTCTCGG No data
985948098_985948104 5 Left 985948098 5:3202231-3202253 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948104 5:3202259-3202281 CTCCACCTTCTCCAGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985948098 Original CRISPR GGTGACAGGCTGCAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr