ID: 985948110

View in Genome Browser
Species Human (GRCh38)
Location 5:3202295-3202317
Sequence GGTGACAGGCTGCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985948110_985948116 5 Left 985948110 5:3202295-3202317 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948116 5:3202323-3202345 CTCCACCTTCTCCAGCAATGAGG No data
985948110_985948119 14 Left 985948110 5:3202295-3202317 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948119 5:3202332-3202354 CTCCAGCAATGAGGTCCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985948110 Original CRISPR GGTGACAGGCTGCAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr