ID: 985948122

View in Genome Browser
Species Human (GRCh38)
Location 5:3202359-3202381
Sequence GGTGACAGGCTGCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985948122_985948131 14 Left 985948122 5:3202359-3202381 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948131 5:3202396-3202418 CTCCAGCAATGAGGTCCTCTCGG No data
985948122_985948128 5 Left 985948122 5:3202359-3202381 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948128 5:3202387-3202409 CTCCACCTTCTCCAGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985948122 Original CRISPR GGTGACAGGCTGCAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr