ID: 985948134

View in Genome Browser
Species Human (GRCh38)
Location 5:3202423-3202445
Sequence GGTGACAGGCTGCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985948134_985948143 14 Left 985948134 5:3202423-3202445 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948143 5:3202460-3202482 CTGCAGCAATGAGGTCCTCTCGG No data
985948134_985948140 5 Left 985948134 5:3202423-3202445 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948140 5:3202451-3202473 CTCCACCTTCTGCAGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985948134 Original CRISPR GGTGACAGGCTGCAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr