ID: 985948145

View in Genome Browser
Species Human (GRCh38)
Location 5:3202487-3202509
Sequence GGTGACAGGCTGCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985948145_985948154 14 Left 985948145 5:3202487-3202509 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948154 5:3202524-3202546 CTCCAGCAATGAGGTCCTCTCGG No data
985948145_985948151 5 Left 985948145 5:3202487-3202509 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948151 5:3202515-3202537 CTCCACCTTCTCCAGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985948145 Original CRISPR GGTGACAGGCTGCAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr