ID: 985948157

View in Genome Browser
Species Human (GRCh38)
Location 5:3202551-3202573
Sequence GGTGACAGGCTGCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985948157_985948166 14 Left 985948157 5:3202551-3202573 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948166 5:3202588-3202610 CTCCAGCAATGAGGTCCTCTCGG No data
985948157_985948163 5 Left 985948157 5:3202551-3202573 CCCTGCACCTGCAGCCTGTCACC No data
Right 985948163 5:3202579-3202601 CTCCACCTTCTCCAGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985948157 Original CRISPR GGTGACAGGCTGCAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr