ID: 985952816

View in Genome Browser
Species Human (GRCh38)
Location 5:3236460-3236482
Sequence CTCTTTGAACAGAGGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985952816_985952822 -2 Left 985952816 5:3236460-3236482 CCTTGCCTCCTCTGTTCAAAGAG No data
Right 985952822 5:3236481-3236503 AGGAGGGTCAGCCATTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985952816 Original CRISPR CTCTTTGAACAGAGGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr