ID: 985959527

View in Genome Browser
Species Human (GRCh38)
Location 5:3290101-3290123
Sequence ATAACCTTTATGTCCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985959524_985959527 18 Left 985959524 5:3290060-3290082 CCAAGAATGAACTGAAACAGGGC No data
Right 985959527 5:3290101-3290123 ATAACCTTTATGTCCAAATAAGG No data
985959522_985959527 19 Left 985959522 5:3290059-3290081 CCCAAGAATGAACTGAAACAGGG No data
Right 985959527 5:3290101-3290123 ATAACCTTTATGTCCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985959527 Original CRISPR ATAACCTTTATGTCCAAATA AGG Intergenic
No off target data available for this crispr