ID: 985962551

View in Genome Browser
Species Human (GRCh38)
Location 5:3313648-3313670
Sequence TGGAGGTCCCAGGTCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985962544_985962551 6 Left 985962544 5:3313619-3313641 CCACGATTTCCAACCTACAGATA No data
Right 985962551 5:3313648-3313670 TGGAGGTCCCAGGTCTACCATGG No data
985962546_985962551 -3 Left 985962546 5:3313628-3313650 CCAACCTACAGATAGGAAACTGG No data
Right 985962551 5:3313648-3313670 TGGAGGTCCCAGGTCTACCATGG No data
985962549_985962551 -7 Left 985962549 5:3313632-3313654 CCTACAGATAGGAAACTGGAGGT No data
Right 985962551 5:3313648-3313670 TGGAGGTCCCAGGTCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985962551 Original CRISPR TGGAGGTCCCAGGTCTACCA TGG Intergenic
No off target data available for this crispr