ID: 985962638

View in Genome Browser
Species Human (GRCh38)
Location 5:3314358-3314380
Sequence GAGGGCTGCAAGGAGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985962638_985962643 -8 Left 985962638 5:3314358-3314380 CCCTCATCCTCCTTGCAGCCCTC No data
Right 985962643 5:3314373-3314395 CAGCCCTCCCTGGCTCTCCTTGG No data
985962638_985962649 0 Left 985962638 5:3314358-3314380 CCCTCATCCTCCTTGCAGCCCTC No data
Right 985962649 5:3314381-3314403 CCTGGCTCTCCTTGGGCCACAGG No data
985962638_985962644 -7 Left 985962638 5:3314358-3314380 CCCTCATCCTCCTTGCAGCCCTC No data
Right 985962644 5:3314374-3314396 AGCCCTCCCTGGCTCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985962638 Original CRISPR GAGGGCTGCAAGGAGGATGA GGG (reversed) Intergenic
No off target data available for this crispr