ID: 985963956

View in Genome Browser
Species Human (GRCh38)
Location 5:3325399-3325421
Sequence GACAAGCCAGTAGGTTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985963956_985963963 22 Left 985963956 5:3325399-3325421 CCACAGCAACCTACTGGCTTGTC No data
Right 985963963 5:3325444-3325466 CGACGGCGCACACGGTGTCTTGG No data
985963956_985963961 14 Left 985963956 5:3325399-3325421 CCACAGCAACCTACTGGCTTGTC No data
Right 985963961 5:3325436-3325458 CACGGAGCCGACGGCGCACACGG No data
985963956_985963964 23 Left 985963956 5:3325399-3325421 CCACAGCAACCTACTGGCTTGTC No data
Right 985963964 5:3325445-3325467 GACGGCGCACACGGTGTCTTGGG No data
985963956_985963959 -4 Left 985963956 5:3325399-3325421 CCACAGCAACCTACTGGCTTGTC No data
Right 985963959 5:3325418-3325440 TGTCATTTTATGATCTGGCACGG No data
985963956_985963958 -9 Left 985963956 5:3325399-3325421 CCACAGCAACCTACTGGCTTGTC No data
Right 985963958 5:3325413-3325435 TGGCTTGTCATTTTATGATCTGG No data
985963956_985963960 5 Left 985963956 5:3325399-3325421 CCACAGCAACCTACTGGCTTGTC No data
Right 985963960 5:3325427-3325449 ATGATCTGGCACGGAGCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985963956 Original CRISPR GACAAGCCAGTAGGTTGCTG TGG (reversed) Intergenic