ID: 985963957

View in Genome Browser
Species Human (GRCh38)
Location 5:3325408-3325430
Sequence TCATAAAATGACAAGCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985963957_985963965 23 Left 985963957 5:3325408-3325430 CCTACTGGCTTGTCATTTTATGA No data
Right 985963965 5:3325454-3325476 CACGGTGTCTTGGGCAGCCTTGG No data
985963957_985963966 24 Left 985963957 5:3325408-3325430 CCTACTGGCTTGTCATTTTATGA No data
Right 985963966 5:3325455-3325477 ACGGTGTCTTGGGCAGCCTTGGG No data
985963957_985963961 5 Left 985963957 5:3325408-3325430 CCTACTGGCTTGTCATTTTATGA No data
Right 985963961 5:3325436-3325458 CACGGAGCCGACGGCGCACACGG No data
985963957_985963963 13 Left 985963957 5:3325408-3325430 CCTACTGGCTTGTCATTTTATGA No data
Right 985963963 5:3325444-3325466 CGACGGCGCACACGGTGTCTTGG No data
985963957_985963964 14 Left 985963957 5:3325408-3325430 CCTACTGGCTTGTCATTTTATGA No data
Right 985963964 5:3325445-3325467 GACGGCGCACACGGTGTCTTGGG No data
985963957_985963960 -4 Left 985963957 5:3325408-3325430 CCTACTGGCTTGTCATTTTATGA No data
Right 985963960 5:3325427-3325449 ATGATCTGGCACGGAGCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985963957 Original CRISPR TCATAAAATGACAAGCCAGT AGG (reversed) Intergenic