ID: 985963963 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:3325444-3325466 |
Sequence | CGACGGCGCACACGGTGTCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
985963956_985963963 | 22 | Left | 985963956 | 5:3325399-3325421 | CCACAGCAACCTACTGGCTTGTC | No data | ||
Right | 985963963 | 5:3325444-3325466 | CGACGGCGCACACGGTGTCTTGG | No data | ||||
985963957_985963963 | 13 | Left | 985963957 | 5:3325408-3325430 | CCTACTGGCTTGTCATTTTATGA | No data | ||
Right | 985963963 | 5:3325444-3325466 | CGACGGCGCACACGGTGTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
985963963 | Original CRISPR | CGACGGCGCACACGGTGTCT TGG | Intergenic | ||