ID: 985963964 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:3325445-3325467 |
Sequence | GACGGCGCACACGGTGTCTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
985963956_985963964 | 23 | Left | 985963956 | 5:3325399-3325421 | CCACAGCAACCTACTGGCTTGTC | No data | ||
Right | 985963964 | 5:3325445-3325467 | GACGGCGCACACGGTGTCTTGGG | No data | ||||
985963957_985963964 | 14 | Left | 985963957 | 5:3325408-3325430 | CCTACTGGCTTGTCATTTTATGA | No data | ||
Right | 985963964 | 5:3325445-3325467 | GACGGCGCACACGGTGTCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
985963964 | Original CRISPR | GACGGCGCACACGGTGTCTT GGG | Intergenic | ||