ID: 985963964

View in Genome Browser
Species Human (GRCh38)
Location 5:3325445-3325467
Sequence GACGGCGCACACGGTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985963956_985963964 23 Left 985963956 5:3325399-3325421 CCACAGCAACCTACTGGCTTGTC No data
Right 985963964 5:3325445-3325467 GACGGCGCACACGGTGTCTTGGG No data
985963957_985963964 14 Left 985963957 5:3325408-3325430 CCTACTGGCTTGTCATTTTATGA No data
Right 985963964 5:3325445-3325467 GACGGCGCACACGGTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985963964 Original CRISPR GACGGCGCACACGGTGTCTT GGG Intergenic
No off target data available for this crispr