ID: 985963965

View in Genome Browser
Species Human (GRCh38)
Location 5:3325454-3325476
Sequence CACGGTGTCTTGGGCAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985963957_985963965 23 Left 985963957 5:3325408-3325430 CCTACTGGCTTGTCATTTTATGA No data
Right 985963965 5:3325454-3325476 CACGGTGTCTTGGGCAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985963965 Original CRISPR CACGGTGTCTTGGGCAGCCT TGG Intergenic