ID: 985964576

View in Genome Browser
Species Human (GRCh38)
Location 5:3330206-3330228
Sequence TGAGAACCCCTGTGATTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985964574_985964576 -8 Left 985964574 5:3330191-3330213 CCTGCCTCTCTCTTCTGAGAACC No data
Right 985964576 5:3330206-3330228 TGAGAACCCCTGTGATTAACTGG No data
985964572_985964576 23 Left 985964572 5:3330160-3330182 CCTTACATCTTCTCGTTCTCACT No data
Right 985964576 5:3330206-3330228 TGAGAACCCCTGTGATTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985964576 Original CRISPR TGAGAACCCCTGTGATTAAC TGG Intergenic
No off target data available for this crispr