ID: 985965168

View in Genome Browser
Species Human (GRCh38)
Location 5:3333932-3333954
Sequence CAGTCAAGGCAGAGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985965154_985965168 26 Left 985965154 5:3333883-3333905 CCTGTGAAGGTGCAGGGGCGCTG No data
Right 985965168 5:3333932-3333954 CAGTCAAGGCAGAGGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985965168 Original CRISPR CAGTCAAGGCAGAGGCAGGG TGG Intergenic
No off target data available for this crispr