ID: 985965545

View in Genome Browser
Species Human (GRCh38)
Location 5:3336670-3336692
Sequence CCACGATAGCAGCTGGTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985965535_985965545 24 Left 985965535 5:3336623-3336645 CCACTGCACATAAAGAGAAATCT No data
Right 985965545 5:3336670-3336692 CCACGATAGCAGCTGGTCCCCGG No data
985965539_985965545 1 Left 985965539 5:3336646-3336668 CCTTGGCGTTGGGACCGCTGAAC No data
Right 985965545 5:3336670-3336692 CCACGATAGCAGCTGGTCCCCGG No data
985965534_985965545 27 Left 985965534 5:3336620-3336642 CCTCCACTGCACATAAAGAGAAA No data
Right 985965545 5:3336670-3336692 CCACGATAGCAGCTGGTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985965545 Original CRISPR CCACGATAGCAGCTGGTCCC CGG Intergenic
No off target data available for this crispr