ID: 985966017

View in Genome Browser
Species Human (GRCh38)
Location 5:3339217-3339239
Sequence CACGGTGCACAAAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985966012_985966017 -6 Left 985966012 5:3339200-3339222 CCAGGGGATTCCCCACACACGGT No data
Right 985966017 5:3339217-3339239 CACGGTGCACAAAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985966017 Original CRISPR CACGGTGCACAAAGAGCAGA GGG Intergenic
No off target data available for this crispr