ID: 985966546

View in Genome Browser
Species Human (GRCh38)
Location 5:3342578-3342600
Sequence CGGTGTGGCCCAGGACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985966546_985966557 28 Left 985966546 5:3342578-3342600 CCCTCTGGTCCTGGGCCACACCG No data
Right 985966557 5:3342629-3342651 CTCTGATGACAGCGGTGCCTCGG No data
985966546_985966552 0 Left 985966546 5:3342578-3342600 CCCTCTGGTCCTGGGCCACACCG No data
Right 985966552 5:3342601-3342623 GATGTGAGAAACATTTTCCCCGG No data
985966546_985966556 20 Left 985966546 5:3342578-3342600 CCCTCTGGTCCTGGGCCACACCG No data
Right 985966556 5:3342621-3342643 CGGTTGAGCTCTGATGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985966546 Original CRISPR CGGTGTGGCCCAGGACCAGA GGG (reversed) Intergenic
No off target data available for this crispr