ID: 985966575

View in Genome Browser
Species Human (GRCh38)
Location 5:3342726-3342748
Sequence CGGTGTGGCCCAGGACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985966575_985966589 30 Left 985966575 5:3342726-3342748 CCCTCTGGTCCTGGGCCACACCG No data
Right 985966589 5:3342779-3342801 TCCAGTGCTTCTCTTGGCAGTGG No data
985966575_985966582 0 Left 985966575 5:3342726-3342748 CCCTCTGGTCCTGGGCCACACCG No data
Right 985966582 5:3342749-3342771 GGTGTGAGAAACGCCTTCCCCGG No data
985966575_985966583 1 Left 985966575 5:3342726-3342748 CCCTCTGGTCCTGGGCCACACCG No data
Right 985966583 5:3342750-3342772 GTGTGAGAAACGCCTTCCCCGGG No data
985966575_985966588 24 Left 985966575 5:3342726-3342748 CCCTCTGGTCCTGGGCCACACCG No data
Right 985966588 5:3342773-3342795 TTGAGCTCCAGTGCTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985966575 Original CRISPR CGGTGTGGCCCAGGACCAGA GGG (reversed) Intergenic
No off target data available for this crispr