ID: 985967418

View in Genome Browser
Species Human (GRCh38)
Location 5:3348184-3348206
Sequence TAGCAGAAGTATAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985967418_985967422 1 Left 985967418 5:3348184-3348206 CCTCCCTCCTTATACTTCTGCTA No data
Right 985967422 5:3348208-3348230 AGATGTCTTGAGAATAAATGAGG No data
985967418_985967423 22 Left 985967418 5:3348184-3348206 CCTCCCTCCTTATACTTCTGCTA No data
Right 985967423 5:3348229-3348251 GGCATTAGCAACCTGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985967418 Original CRISPR TAGCAGAAGTATAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr