ID: 985967418 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:3348184-3348206 |
| Sequence | TAGCAGAAGTATAAGGAGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985967418_985967422 | 1 | Left | 985967418 | 5:3348184-3348206 | CCTCCCTCCTTATACTTCTGCTA | No data | ||
| Right | 985967422 | 5:3348208-3348230 | AGATGTCTTGAGAATAAATGAGG | No data | ||||
| 985967418_985967423 | 22 | Left | 985967418 | 5:3348184-3348206 | CCTCCCTCCTTATACTTCTGCTA | No data | ||
| Right | 985967423 | 5:3348229-3348251 | GGCATTAGCAACCTGTTCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985967418 | Original CRISPR | TAGCAGAAGTATAAGGAGGG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||