ID: 985968949

View in Genome Browser
Species Human (GRCh38)
Location 5:3360347-3360369
Sequence CAGTGGGTATTTAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985968949_985968955 -4 Left 985968949 5:3360347-3360369 CCTTCCTCCCTAAATACCCACTG No data
Right 985968955 5:3360366-3360388 ACTGTGTCTGAGTTGTTTCTAGG No data
985968949_985968959 23 Left 985968949 5:3360347-3360369 CCTTCCTCCCTAAATACCCACTG No data
Right 985968959 5:3360393-3360415 CACTCTCCACGCTTCTCTTAGGG No data
985968949_985968958 22 Left 985968949 5:3360347-3360369 CCTTCCTCCCTAAATACCCACTG No data
Right 985968958 5:3360392-3360414 CCACTCTCCACGCTTCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985968949 Original CRISPR CAGTGGGTATTTAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr