ID: 985969355

View in Genome Browser
Species Human (GRCh38)
Location 5:3362753-3362775
Sequence GGCACTGGTGTCCCTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985969355_985969361 10 Left 985969355 5:3362753-3362775 CCTGGAGTAGGGACACCAGTGCC No data
Right 985969361 5:3362786-3362808 GCCCAGACACCCCTGACGTGTGG No data
985969355_985969367 23 Left 985969355 5:3362753-3362775 CCTGGAGTAGGGACACCAGTGCC No data
Right 985969367 5:3362799-3362821 TGACGTGTGGTTTCAGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985969355 Original CRISPR GGCACTGGTGTCCCTACTCC AGG (reversed) Intergenic
No off target data available for this crispr