ID: 985971389

View in Genome Browser
Species Human (GRCh38)
Location 5:3381213-3381235
Sequence CCATGGCCTCCAAGCCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985971389_985971397 4 Left 985971389 5:3381213-3381235 CCTAGCTGGCTTGGAGGCCATGG No data
Right 985971397 5:3381240-3381262 CACTGGGTGAAGACCCAGTGTGG No data
985971389_985971398 12 Left 985971389 5:3381213-3381235 CCTAGCTGGCTTGGAGGCCATGG No data
Right 985971398 5:3381248-3381270 GAAGACCCAGTGTGGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985971389 Original CRISPR CCATGGCCTCCAAGCCAGCT AGG (reversed) Intergenic
No off target data available for this crispr